.


:




:

































 

 

 

 


қ: ә ң қ ң




7.2. қ: ә ң ң ұқ қ қң ң қ қ.

7.3. қң :

- ң ң қ;

- ң ә ңң қ ң қ;

- ү қ ң ө қ;

- ғң қ ө қ.

 

7.4. Ө ү: ә ү, қ ө.

7.5. қ :

7.5.1. ғ. Қ ң қ . Қ ң қ ә ң. Қ Қ ң 5'-3' ұ ң.

-Қ 7 met- G-AUGUUUCUACACACGGUAGACGCCGGCUGGCGAUAG (A)

 

7.5.2. ғ. Қ ң қ ң қ , -Қ ң құ қң. Қ ң 5'-3' ұ өң.

Қ 5' ATGGACGAAAATCCGGATCGCCAAGGTATTTTGA3'

 

7.5.3. үң ңң ә ғ қ .

7.5.4. ғ (қ ә . қ құ

. Ө. Ққ ., .40-43, 2,3,6,7,8.

7.6. Ү -қ.

 

7.7. Ә:

:

7.7.1. . . .. .: , 2006. . 54, 201-210.

7.7.2. .. . .: , 2003. . 35-46.

7.7.3. .., .. . ., 2003. . 85-148.

7.7.4. Ққ .Ө., .. қ (ә ғ). : , 2008. .40-62.

7.7.5. қ ә . .Ө. Ққң . , 2004. . 30-43.

7.7.6. Ққ .Ө., ұ Ұ.Ә. қ-қ ң -ққ ө. : , 2012.

 

Қ:

7.7.7. .., .. . ., 2005. . 243-295.

7.7.8. .. . , .. -, 2007. . 123-126, 172-196.

7.7.9. : . / ., . -, . : . . . . ; . . . . . ., -, 2010.

қ

7.8.1. ғ ң

7.8.2. қ ұқ:

 

7.8.2.1. ҳ ғң (ң) ң ө ң.

7.8.2.2. , қ, .

7.8.2.3. -Қ қ , ң

ғ.

7.8.2.4. ү қ .

7.8.2.5. ә ң :

1)

2)

3) .

Ү ү ө:

Ққ ғ
ұқ қ қң Қ- -Қ-ғ ө ү - ranscription - process of rewriting of genetic information from DNA to RNA
Қ - -Қ - , - RNA-polymerase -enzyme taking part on synthesis of m-RNA molecules
- құғ қ - Pribnov-box regulatorysequence inside of promotr
ң () ә қ -Қ ү ң ғ , () Transcriptomics science studying gene expression and processing  
қ (50 ) ә Қ ( 50) - Transcriptosoma complex structure consisting from general factors of transcription and RNA- polymerase
ғқ қ Қ ү - Processing process of maturation of primary eukaryotic m-RNA
Қғ ң ү - Splicing process of joining of exons in mature eukaryotic m-RNA
Қғ ң әү ү ү - Alternative splicing process of joining of exons in various combinations during processing of m-RNA
қ қ, қ Қң ү ққ ә қ , -, Intron sequence of nucleotides cutting and removing during processing of nucleic m-RNA, doesnt take part in translation
қ қ, Қ қ қ қ , - Exon sequence of nucleotides remaining in mature m-RNA and taking part in translation

 

 

Құ: қ. ..

3-қ (Ө)





:


: 2017-02-11; !; : 841 |


:

:

, ; , .
==> ...

1987 - | 1783 -


© 2015-2024 lektsii.org - -

: 0.01 .