.


:




:

































 

 

 

 


() құ ғ




6.7.1.1. қң ұқ ұ.

6.7.1.2. қ 10 ұқ 2 ұ.

6.7.1.3. қ ә ғ ә

 

6.7.2. ә ғ құ ғ:

6.7.2.1. ң үң ң ү ә ғ қ .

6.7.2.2. ң үң ңң ү ә ғ қ .

6.7.2.3. қ -Қ - ү ү ә .

6.7.2.4. ғ:

1) Қ ң қ . Қ ң қ ә ң. Қ Қ ң 5'-3' ұ ң.

-Қ 7 met- G-AUGUUUCUACACACGGUAGACGCCGGCUGGCGAUAG (A)

 

2) Қ ң қ ң қ , -Қ ң құ қң. Қ ң 5'-3' ұ өң.

Қ 5' ATGGACGAAAATCCGGATCGCCAAGGTATTTTGA3'

 

6.7.4. ғ (қ ә . қ құ . Ө. Ққ ., .43, 1, 11.

6.7.3. қ ұқ:

6.7.3.1. ҳ ғң (ң) ң ө ң.

6.7.3.2. - ә ң қ.

Ү ү ө:

Ққ ғ
ұқ қ қң Қ- -Қ-ғ ө ү - ranscription - process of rewriting of genetic information from DNA to RNA
Қ - -Қ - , - RNA-polymerase -enzyme taking part on synthesis of m-RNA molecules
- құғ қ - Pribnov-box regulatorysequence inside of promotr
ң () ә қ -Қ ү ң ғ , () Transcriptomics science studying gene expression and processing  
қ (50 ) ә Қ ( 50) - Transcriptosoma complex structure consisting from general factors of transcription and RNA- polymerase
ғқ қ Қ ү - Processing process of maturation of primary eukaryotic m-RNA
Қғ ң ү - Splicing process of joining of exons in mature eukaryotic m-RNA
Қғ ң әү ү ү - Alternative splicing process of joining of exons in various combinations during processing of m-RNA
-Қ-ң ә ғқ қ ң ү - Transcription initiation binding and formation of the first inter-nucleotide bond
-ғқ Қ өң ұ - Transcription elongation gradual extension of the chain of primary mRNA transcript
-ң қ - Termination the end of transcription
- a , b () b¢( ) ә w () ұ - a , b () b¢( ) w () Core-enzymeconsists of two a (alpha), b (beta) b¢(beta prime) and w (omega) subunits
- s¢ қғ қ қ қ Қ- ү - - s¢ ()- - - Holoenzyme addition ofs¢ (sigma)-subunit to core-enzyme leads to formation of fully active functional form of RNA-polymerase

 

Құ: қ. ..

5 - ә қ





:


: 2016-12-04; !; : 676 |


:

:

: , .
==> ...

2376 - | 1984 -


© 2015-2024 lektsii.org - -

: 0.009 .